R 3 is H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, optionally substituted C 3 -C 6 cycloalkyl, optionally substituted C 2 -C 7 heterocycloalkyl, optionally substituted C 6 -C 10 aryl, optionally substituted C 3 -C 9 heteroaryl, OR 6 , NR 5 R 6 , C(O)R 7 , -0O 2 R 6 , C(O)NR 5 R 6 , N(R 5 )C(O)R 7 , N(R 5 )CO 2 R 7 , NHS(O) 2 R 7 , S(O) 2 NR 5 R 6 , or R 2 and R 3 together form an optionally substituted C 2 -C 7 heterocycloalkyl ring
Drug repurposing for next-generation combination therapies against multidrug-resistant bacteria
2014;9:e108421
antisense, AGCCTTCAGTTTGGAGACCACTAT generating a 690 nt amplicon (annealing 55 C, 36 cycles)
Probing the folding pathways of long R3 insulin-like growth factor-I (LR3IGF-I) and IGF-I via capture and identification of disulfide intermediates by cyanylation methodology and mass spectrometry